|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 86 T | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 86-th site |
REPEAT: /note="LRR 2" VAR_SEQ: /note="Missing (in isoform 2)" /id="VSP_054188" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
N:11% Q:10% K:10% S:10% R:8% E:7% L:7% T:5% A:4% C:4% H:4% M:4% Y:3% D:2% G:2% I:2% F:2% P:2% V:2% W:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
(coil) | e (exposed) | 46.1 |
Predicted Bind Molecules |
nucleotide:30 |
Templates for 3D complexes |
nucleotide [auucugcggauuauuuggcaaaggaagcauugacacaugcgccaau ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |