|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 65 R | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 65-th site |
REPEAT: /note="LRR 1" VAR_SEQ: /note="Missing (in isoform 2)" /id="VSP_054188" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
G:17% R:12% S:11% E:9% T:9% K:8% A:6% N:5% H:5% V:5% D:3% Q:3% L:2% M:2% C:1% I:1% F:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
(coil) | e (exposed) | 58.1 |
Predicted Bind Molecules |
nucleotide:9 compound:4 |
Templates for 3D complexes |
nucleotide [xxxxxxxxugaaggccuguuuccuaggcuacauacgagggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgcaccaaccacacggggcucauucucagcgcxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |