Summary for the 65-th Site(R)

PID QueryLength FocusSite TITLE
2690321 904 65 R RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor;
UniProt Information
AC/IDAC:O15455 ID:TLR3_HUMAN
Feature Table for 65-th site REPEAT: /note="LRR 1"
VAR_SEQ: /note="Missing (in isoform 2)" /id="VSP_054188"
TOPO_DOM: /note="Lumenal"
CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
G:17% R:12% S:11% E:9% T:9% K:8% A:6% N:5% H:5% V:5% D:3% Q:3% L:2% M:2% C:1% I:1% F:1% Y:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7c76 (coil) e (exposed) 58.1
3D Complex Information
Predicted Bind Molecules
nucleotide:9 compound:4
Templates for 3D complexes
nucleotide [xxxxxxxxugaaggccuguuuccuaggcuacauacgagggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgcaccaaccacacggggcucauucucagcgcxxx ] 7das_A_1_C_1 [aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaauuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu ] 7wm4_B_1_E_1 [XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX ] 7wv3_C_1_F_1 [XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX ] 7wv5_A_1_D_1 7wve_A_1_D_1 7wvf_A_1_D_1 [cccccccccccccccccccccccccccccccccccccccccccccc ] 7wv5_B_1_C_1 7wve_B_1_C_1 7wvf_B_1_C_1 compound [NAG ] 3ulv_A_1_N_1 7wm4_A_1_IA_1 7wm4_B_1_KA_1 7wm4_D_1_QA_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]