|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 619 K | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 619-th site |
REPEAT: /note="LRR 22" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
N:17% G:16% H:11% R:8% S:8% A:6% D:6% Q:6% K:6% Y:4% E:3% P:3% F:2% I:1% L:1% M:1% T:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
T (Hbond turn) | e (exposed) | 47.6 |
Predicted Bind Molecules |
nucleotide:24 |
Templates for 3D complexes |
nucleotide [auucugcggauuauuuggcaaaggaagcauugacacaugcgccaau ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |