|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 597 N | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 597-th site |
REPEAT: /note="LRR 21" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
N:15% Q:12% K:12% R:10% S:10% H:6% A:5% L:5% D:4% E:4% P:4% G:2% M:2% Y:2% C:1% I:1% F:1% T:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
(coil) | e (exposed) | 49.1 |
Predicted Bind Molecules |
nucleotide:20 |
Templates for 3D complexes |
nucleotide [xxxxxxxxugaaggccuguuuccuaggcuacauacgagggacauguuccuuaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcagugcgaccuggcucgcaccaaccacacggggcucauucucagcxxxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |