|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 543 A | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 543-th site |
HELIX: REPEAT: /note="LRR 19" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
S:17% T:16% E:11% A:8% R:6% Q:6% K:6% V:6% L:5% G:4% D:3% H:3% I:2% F:2% P:2% N:1% C:1% M:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
T (Hbond turn) | b (buried) | 17.0 |
Predicted Bind Molecules |
nucleotide:7 |
Templates for 3D complexes |
nucleotide [auuggcgcaugugucaaugcuuccuuugccaaauaauccgcagaau ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |