Summary for the 520-th Site(N)

PID QueryLength FocusSite TITLE
2690321 904 520 N RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor;
UniProt Information
AC/IDAC:O15455 ID:TLR3_HUMAN
Feature Table for 520-th site REPEAT: /note="LRR 18"
TOPO_DOM: /note="Lumenal"
CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
S:15% G:12% N:11% E:10% T:7% A:6% V:6% R:5% D:5% Y:5% Q:3% H:3% I:2% L:2% K:2% F:2% C:1% M:1% P:1% W:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7c76 (coil) e (exposed) 46.1
3D Complex Information
Predicted Bind Molecules
nucleotide:3
Templates for 3D complexes
nucleotide [auucugcggauuauuuggcaaaggaagcauugacacaugcgccaau ] 3ciy_C_1_A_1 [auuggcgcaugugucaaugcuuccuuugccaaauaauccgcagaau ] 3ciy_D_1_B_1 [xxxxxxxxugaaggccuguuuccuaggcuacauacgagggacauguuccuuaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcagugcgaccuggcucgcaccaaccacacggggcucauucucagcxxxxx ] 7da7_B_1_C_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]