|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 88 S | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 88-th site |
REPEAT: /note="LRR 2" VAR_SEQ: /note="Missing (in isoform 2)" /id="VSP_054188" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
S:26% T:13% R:10% E:8% N:6% A:5% G:5% K:5% Q:4% P:3% V:3% D:2% H:2% L:2% Y:2% C:1% I:1% M:1% F:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
S (bend) | e (exposed) | 67.2 |
Predicted Bind Molecules |
nucleotide:18 |
Templates for 3D complexes |
nucleotide [auuggcgcaugugucaaugcuuccuuugccaaauaauccgcagaau ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |