|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 61 N | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 61-th site |
REPEAT: /note="LRR 1" VAR_SEQ: /note="Missing (in isoform 2)" /id="VSP_054188" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
N:86% T:4% C:2% G:2% L:2% S:2% R:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
S (bend) | b (buried) | 6.1 |
Predicted Bind Molecules |
nucleotide:15 |
Templates for 3D complexes |
nucleotide [auucugcggauuauuuggcaaaggaagcauugacacaugcgccaau ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |