Summary for the 595-th Site(L)

PID QueryLength FocusSite TITLE
2690321 904 595 L RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor;
UniProt Information
AC/IDAC:O15455 ID:TLR3_HUMAN
Feature Table for 595-th site REPEAT: /note="LRR 21"
TOPO_DOM: /note="Lumenal"
CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
N:14% G:13% H:11% R:8% L:8% D:6% F:6% C:5% E:5% S:5% Y:4% I:3% K:3% A:2% Q:2% T:2% M:1% W:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7c76 S (bend) e (exposed) 27.5
3D Complex Information
Predicted Bind Molecules
hetero:2 nucleotide:1
Templates for 3D complexes
hetero [50043 ] 3ulu_A_1_B_1 3ulv_A_1_B_1 nucleotide [xxxxxxxxugaaggccuguuuccuaggcuacauacgagggacauguuccuuaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcagugcgaccuggcucgcaccaaccacacggggcucauucucagcxxxxx ] 7da7_A_1_C_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]