|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 573 G | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 573-th site |
REPEAT: /note="LRR 20" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
G:20% A:9% R:9% S:9% Q:7% K:7% N:6% D:4% E:4% H:4% L:4% I:3% F:3% P:3% C:2% M:2% T:2% Y:2% V:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
(coil) | e (exposed) | 23.8 |
Predicted Bind Molecules |
nucleotide:24 |
Templates for 3D complexes |
nucleotide [auuggcgcaugugucaaugcuuccuuugccaaauaauccgcagaau ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |