Summary for the 572-nd Site(N) |
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 572 N | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 572-th site |
REPEAT: /note="LRR 20" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
N:56% S:9% Q:6% C:4% L:4% G:3% H:3% K:3% T:3% V:3% A:2% M:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7c76 | S (bend) | b (buried) | 7.9 |
Predicted Bind Molecules |
nucleotide:9 |
Templates for 3D complexes |
nucleotide [xxxxxxxxugaaggccuguuuccuaggcuacauacgagggacauguuccuuaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcagugcgaccuggcucgcaccaaccacacggggcucauucucagcxxxxx ] 7da7_B_1_C_1 [aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaauuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu ] 7wm4_D_1_F_1 [cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc ] 7wv3_A_1_E_1 7wv3_D_1_E_1 [XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX ] 7wv3_C_1_F_1 7wv4_D_1_F_1 [XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX ] 7wve_A_1_D_1 [cccccccccccccccccccccccccccccccccccccccccccccc ] 7wve_B_1_C_1 7wvj_B_1_C_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |