|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 520 N | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 520-th site |
REPEAT: /note="LRR 18" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
S:15% G:12% N:11% E:10% T:7% A:6% V:6% R:5% D:5% Y:5% Q:3% H:3% I:2% L:2% K:2% F:2% C:1% M:1% P:1% W:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
(coil) | e (exposed) | 46.1 |
Predicted Bind Molecules |
nucleotide:3 |
Templates for 3D complexes |
nucleotide [auucugcggauuauuuggcaaaggaagcauugacacaugcgccaau ] ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |