|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 112 S | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 112-th site |
REPEAT: /note="LRR 3" VAR_SEQ: /note="Missing (in isoform 2)" /id="VSP_054188" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
S:15% T:11% Q:10% R:8% A:7% N:7% E:5% G:5% K:5% V:5% L:4% H:3% I:3% P:3% D:2% C:2% M:2% Y:2% F:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
(coil) | e (exposed) | 45.3 |
Predicted Bind Molecules |
nucleotide:8 |
Templates for 3D complexes |
nucleotide [auuggcgcaugugucaaugcuuccuuugccaaauaauccgcagaau ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |