|
PID | QueryLength | FocusSite | TITLE |
2690321 | 904 | 110 E | RecName: Full=Toll-like receptor 3 ;AltName: CD_antigen=CD283;Flags: Precursor; |
AC/ID | AC:O15455 ID:TLR3_HUMAN |
Feature Table for 110-th site |
STRAND: REPEAT: /note="LRR 3" VAR_SEQ: /note="Missing (in isoform 2)" /id="VSP_054188" TOPO_DOM: /note="Lumenal" CHAIN: /note="Toll-like receptor 3" /id="PRO_0000034715" |
Percentages of Amino Acids in Homologous Proteins
![]() |
N:16% K:13% Q:11% R:9% E:9% A:7% S:6% P:5% D:4% G:4% H:3% L:3% F:3% T:2% Y:2% C:1% I:1% M:1% W:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
(coil) | e (exposed) | 43.7 |
Predicted Bind Molecules |
nucleotide:37 |
Templates for 3D complexes |
nucleotide [auucugcggauuauuuggcaaaggaagcauugacacaugcgccaau ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |