Summary for the 86-th Site(K)

PID QueryLength FocusSite TITLE
2624989 215 86 K RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 86-th site REGION: /note="LPS binding (Lipid A)"
COMPBIAS: /note="Basic and acidic residues"
REGION: /note="Disordered"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:51% R:19% E:7% G:7% S:4% N:3% Q:3% Y:3% A:2% T:2% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq S (bend) e (exposed) 85.8
3D Complex Information
Predicted Bind Molecules
nucleotide:1
Templates for 3D complexes
nucleotide [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cij_G_1_K_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]