Summary for the 20-th Site(V)

PID QueryLength FocusSite TITLE
2624989 215 20 V RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 20-th site HELIX:
DNA_BIND: /note="HMG box 1"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
S:23% V:20% L:18% A:15% M:12% C:5% F:5% K:4% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq H (alpha-helix) b (buried) 16.7
3D Complex Information
Predicted Bind Molecules
hetero:1 nucleotide:4
Templates for 3D complexes
hetero [15202:P53_HUMAN ] 2ly4_A_1_B_1 nucleotide [ggaaggtccagagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_B_1 [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_C_1 4qr9_B_1_D_1 [xxggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cim_E_1_I_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]