Summary for the 20-th Site(V) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 20 V | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 20-th site |
HELIX: DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:23% V:20% L:18% A:15% M:12% C:5% F:5% K:4% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | H (alpha-helix) | b (buried) | 16.7 |
Predicted Bind Molecules |
hetero:1 nucleotide:4 |
Templates for 3D complexes |
hetero [15202:P53_HUMAN ] 2ly4_A_1_B_1 nucleotide [ggaaggtccagagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_B_1 [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_C_1 4qr9_B_1_D_1 [xxggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cim_E_1_I_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |