Summary for the 100-th Site(S) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 100 S | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 100-th site |
MOD_RES: /note="Phosphoserine" REGION: /note="Cytokine-stimulating activity" DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:56% T:18% N:14% E:6% G:4% A:1% L:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | (coil) | e (exposed) | 49.2 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [xxggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cil_E_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |