Summary for the 97-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 97 R | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 97-th site |
REGION: /note="Cytokine-stimulating activity" DNA_BIND: /note="HMG box 2" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:74% K:14% S:4% A:3% I:2% P:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | (coil) | e (exposed) | 64.0 |
Predicted Bind Molecules |
nucleotide:4 |
Templates for 3D complexes |
nucleotide [gggatctaaacaatgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_A_1 [gcattgtttagatcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_B_1 [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cg0_K_1_J_1 6cij_G_1_K_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |