Summary for the 45-th Site(C) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 45 C | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 45-th site |
MOD_RES: /note="Cysteine sulfonic acid (-SO3H); alternate" HELIX: DISULFID: /note="In disulfide HMGB1; alternate" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
L:33% C:22% I:16% A:13% G:7% V:7% T:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | H (alpha-helix) | b (buried) | 0.0 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cg0_K_1_J_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |