Summary for the 36-th Site(V) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 36 V | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 36-th site |
MOTIF: /note="Nuclear localization signal (NLS) 1" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:30% I:19% L:9% E:7% K:7% P:7% A:4% M:4% N:3% T:3% R:1% D:1% Q:1% G:1% F:1% S:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | (coil) | e (exposed) | 47.3 |
Predicted Bind Molecules |
hetero:1 nucleotide:5 |
Templates for 3D complexes |
hetero [15202:P53_HUMAN ] 2ly4_A_1_B_1 nucleotide [ggaaggtccagagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_B_1 [gggatctaaacaatgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_A_1 [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_C_1 4qr9_B_1_D_1 [cgggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatccagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cg0_K_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |