Summary for the 12-nd Site(K) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 12 K | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 12-th site |
MOD_RES: /note="N6-acetyllysine" REGION: /note="LPS binding (delipidated)" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
P:34% A:17% N:15% K:11% G:5% R:4% S:3% Y:3% D:1% Q:1% E:1% I:1% L:1% F:1% T:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | (coil) | b (buried) | 19.8 |
Predicted Bind Molecules |
nucleotide:6 |
Templates for 3D complexes |
nucleotide [ccXctctggaccttccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_A_1 [ggaaggtccagagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_B_1 [ggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5zdz_E_1_I_1 5ze0_E_1_I_1 5ze1_E_1_I_1 [cgggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatccagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cij_G_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |