Summary for the 36-th Site(V)

PID QueryLength FocusSite TITLE
2624989 215 36 V RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 36-th site MOTIF: /note="Nuclear localization signal (NLS) 1"
DNA_BIND: /note="HMG box 1"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
V:30% I:19% L:9% E:7% K:7% P:7% A:4% M:4% N:3% T:3% R:1% D:1% Q:1% G:1% F:1% S:1% Y:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq (coil) e (exposed) 47.3
3D Complex Information
Predicted Bind Molecules
hetero:1 nucleotide:5
Templates for 3D complexes
hetero [14906:P53_HUMAN ] 2ly4_A_1_B_1 nucleotide [ggaaggtccagagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_B_1 [gggatctaaacaatgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_A_1 [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_C_1 4qr9_B_1_D_1 [cgggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatccagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cg0_K_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]