Summary for the 28-th Site(K)

PID QueryLength FocusSite TITLE
2624989 215 28 K RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 28-th site MOD_RES: /note="N6-acetyllysine"
CROSSLNK: /note="Isoglutamyl lysine isopeptide (Lys-Gln) (interchain with Q-?)"
HELIX:
MOTIF: /note="Nuclear localization signal (NLS) 1"
DNA_BIND: /note="HMG box 1"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:65% R:13% V:8% Q:7% G:2% I:2% L:2% N:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq H (alpha-helix) e (exposed) 51.4
3D Complex Information
Predicted Bind Molecules
hetero:1 nucleotide:4
Templates for 3D complexes
hetero [14906:P53_HUMAN ] 2ly4_A_1_B_1 nucleotide [ggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5zdz_E_1_I_1 5ze0_E_1_I_1 5ze1_E_1_I_1 [cggtttttgtctggcttcacacttgatttgcatcactgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5ze2_E_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]