Summary for the 118-th Site(P) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 118 P | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 118-th site |
STRAND: DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
P:71% L:7% S:6% A:3% D:3% G:3% K:3% N:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | S (bend) | e (exposed) | 85.3 |
Predicted Bind Molecules |
homo:1 nucleotide:2 |
Templates for 3D complexes |
homo [19348:HMGD_DROME ] 3nm9_B_1_E_1 nucleotide [xxxxgatctggcctgtcttacacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oem_I_1_H_1 6oen_I_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |