Summary for the 118-th Site(P)

PID QueryLength FocusSite TITLE
2624989 215 118 P RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 118-th site STRAND:
DNA_BIND: /note="HMG box 2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
P:71% L:7% S:6% A:3% D:3% G:3% K:3% N:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq S (bend) e (exposed) 85.3
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:2
Templates for 3D complexes
homo [19348:HMGD_DROME ] 3nm9_B_1_E_1 nucleotide [xxxxgatctggcctgtcttacacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oem_I_1_H_1 6oen_I_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]