Summary for the 97-th Site(R)
PID QueryLength FocusSite TITLE
2624989 215 97 R RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 97-th site REGION: /note="Cytokine-stimulating activity"
DNA_BIND: /note="HMG box 2"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
R:74% K:14% S:4% A:3% I:2% P:2%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq (coil) e (exposed) 64.0
3D Complex Information
Predicted Bind Molecules
nucleotide:2
Templates for 3D complexes
nucleotide [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cg0_K_1_J_1 6cij_G_1_K_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]