|
|
| PID | QueryLength | FocusSite | TITLE |
| 2624989 | 215 | 107 S | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
| AC/ID | AC:P09429 ID:HMGB1_HUMAN |
| Feature Table for 107-th site |
HELIX: REGION: /note="Cytokine-stimulating activity" DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
Q:18% N:15% S:14% K:13% A:11% E:11% R:6% D:2% G:2% M:2% Y:2% I:1% L:1% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 2yrq |
H (alpha-helix) | e (exposed) | 31.2 |
| Predicted Bind Molecules |
| nucleotide:3 precipitant:2 |
| Templates for 3D complexes |
|
nucleotide [cgggtttttgttaagggctgtatcactgtgtaagacaggccagatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oem_J_1_G_1 6oen_J_1_G_1 [xxxxgatctggcctgtcttacacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oer_I_1_H_1
precipitant [BME ] 1hsm_A_1_B_1 1hsn_A_1_B_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 107-th Site(S)