|
|
| PID | QueryLength | FocusSite | TITLE |
| 2624989 | 215 | 101 A | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
| AC/ID | AC:P09429 ID:HMGB1_HUMAN |
| Feature Table for 101-th site |
HELIX: REGION: /note="Cytokine-stimulating activity" DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
A:60% G:14% S:11% I:6% P:6% M:2% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 2yrq |
H (alpha-helix) | b (buried) | 0.0 |
| Predicted Bind Molecules |
| nucleotide:3 |
| Templates for 3D complexes |
|
nucleotide [xxxxgatctggcctgtcttacacagtgatacagcccttaacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oem_J_1_F_1 6oen_J_1_F_1 6oeo_I_1_F_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 101-st Site(A)