Summary for the 95-th Site(P) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 95 P | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 95-th site |
REGION: /note="LPS binding (Lipid A)" REGION: /note="Disordered" REGION: /note="Cytokine-stimulating activity" DNA_BIND: /note="HMG box 2" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
P:88% I:5% R:2% L:2% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | (coil) | e (exposed) | 23.3 |
Predicted Bind Molecules |
nucleotide:2 precipitant:2 |
Templates for 3D complexes |
nucleotide [gcattgtttagatcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_B_1 [taacaattgaatgtctgcacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6hb4_D_1_F_1 precipitant [GOL ] 6hb4_A_1_M_1 6hb4_A_1_N_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |