Summary for the 95-th Site(P)
PID QueryLength FocusSite TITLE
2624989 215 95 P RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 95-th site REGION: /note="LPS binding (Lipid A)"
REGION: /note="Disordered"
REGION: /note="Cytokine-stimulating activity"
DNA_BIND: /note="HMG box 2"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
P:88% I:5% R:2% L:2% V:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq (coil) e (exposed) 23.3
3D Complex Information
Predicted Bind Molecules
nucleotide:2 precipitant:2
Templates for 3D complexes
nucleotide [gcattgtttagatcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_B_1 [taacaattgaatgtctgcacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6hb4_D_1_F_1 precipitant [GOL ] 6hb4_A_1_M_1 6hb4_A_1_N_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]