|
|
| PID | QueryLength | FocusSite | TITLE |
| 2624989 | 215 | 90 K | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
| AC/ID | AC:P09429 ID:HMGB1_HUMAN |
| Feature Table for 90-th site |
MOD_RES: /note="N6-acetyllysine" REGION: /note="LPS binding (Lipid A)" COMPBIAS: /note="Basic and acidic residues" REGION: /note="Disordered" REGION: /note="Cytokine-stimulating activity" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
K:55% R:17% T:8% N:3% E:3% I:3% L:3% A:2% D:2% H:2% S:2% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 2yrq |
(coil) | e (exposed) | 66.0 |
| Predicted Bind Molecules |
| hetero:2 nucleotide:8 precipitant:1 |
| Templates for 3D complexes |
|
hetero [95688:RAG1_MOUSE
] 6cij_G_1_A_1 6cij_G_1_B_1
nucleotide [gcattgtttagatcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_B_1 [taacagtcaccccccaacXaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3tq6_A_1_C_1 3tq6_B_1_E_1 [ggcctatcxxxxxgcggtatgcacttttaacagtcaccccccaactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6erp_A_1_C_1 6erp_D_1_F_1 [ggcctgtcxxxxxggtttggttggttcggggtatggggttagcagcggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6erq_D_1_F_1 [ctgtgcagacattcaattgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6hb4_D_1_E_1 [ttaacagtcaccccccaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbx_A_1_C_1
precipitant [GOL ] 6hb4_A_1_M_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 90-th Site(K)