|
|
| PID | QueryLength | FocusSite | TITLE |
| 2624989 | 215 | 86 K | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
| AC/ID | AC:P09429 ID:HMGB1_HUMAN |
| Feature Table for 86-th site |
REGION: /note="LPS binding (Lipid A)" COMPBIAS: /note="Basic and acidic residues" REGION: /note="Disordered" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
K:51% R:19% E:7% G:7% S:4% N:3% Q:3% Y:3% A:2% T:2% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 2yrq |
S (bend) | e (exposed) | 85.8 |
| Predicted Bind Molecules |
| nucleotide:7 |
| Templates for 3D complexes |
|
nucleotide [gttagttggggggtgactgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3tq6_A_1_D_1 [tttattattttatattatataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5jgh_A_1_E_1 5jgh_G_1_K_1 5jgh_J_1_H_1 [aataataaattatataatataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5jh0_A_1_E_1 [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cij_G_1_K_1 [taacaattgaatgtctgcacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6hb4_D_1_F_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 86-th Site(K)