Summary for the 85-th Site(T)
PID QueryLength FocusSite TITLE
2624989 215 85 T RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 85-th site REGION: /note="LPS binding (Lipid A)"
COMPBIAS: /note="Basic and acidic residues"
REGION: /note="Disordered"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
A:8% R:8% N:8% Q:8% E:8% G:8% I:8% L:8% K:8% S:8% T:8% V:8%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq S (bend) e (exposed) 81.2
3D Complex Information
Predicted Bind Molecules
nucleotide:4
Templates for 3D complexes
nucleotide [gggatctaaacaatgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_A_1 [gttagttggggggtgactgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3tq6_A_1_D_1 3tq6_B_1_F_1 [ctaagagctaatagaaaggctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbw_B_1_F_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]