Summary for the 85-th Site(T) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 85 T | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 85-th site |
REGION: /note="LPS binding (Lipid A)" COMPBIAS: /note="Basic and acidic residues" REGION: /note="Disordered" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:8% R:8% N:8% Q:8% E:8% G:8% I:8% L:8% K:8% S:8% T:8% V:8% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | S (bend) | e (exposed) | 81.2 |
Predicted Bind Molecules |
nucleotide:4 |
Templates for 3D complexes |
nucleotide [gggatctaaacaatgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_A_1 [gttagttggggggtgactgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3tq6_A_1_D_1 3tq6_B_1_F_1 [ctaagagctaatagaaaggctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbw_B_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |