|
|
| PID | QueryLength | FocusSite | TITLE |
| 2624989 | 215 | 45 C | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
| AC/ID | AC:P09429 ID:HMGB1_HUMAN |
| Feature Table for 45-th site |
MOD_RES: /note="Cysteine sulfonic acid (-SO3H); alternate" HELIX: DISULFID: /note="In disulfide HMGB1; alternate" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
L:33% C:22% I:16% A:13% G:7% V:7% T:2% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 2yrq |
H (alpha-helix) | b (buried) | 0.0 |
| Predicted Bind Molecules |
| nucleotide:1 |
| Templates for 3D complexes |
|
nucleotide [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cg0_K_1_J_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 45-th Site(C)