Summary for the 176-th Site(V)
PID QueryLength FocusSite TITLE
2624989 215 176 V RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 176-th site COMPBIAS: /note="Basic and acidic residues"
REGION: /note="Binding to AGER/RAGE"
REGION: /note="Disordered"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
V:22% A:13% R:13% L:11% E:9% P:8% I:5% S:5% N:4% D:4% G:4%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
6hb4 T (Hbond turn) e (exposed) 54.2
3D Complex Information
Predicted Bind Molecules
nucleotide:1
Templates for 3D complexes
nucleotide [ctgtgcagacattcaattgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6hb4_A_1_B_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]