Summary for the 176-th Site(V) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 176 V | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 176-th site |
COMPBIAS: /note="Basic and acidic residues" REGION: /note="Binding to AGER/RAGE" REGION: /note="Disordered" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:22% A:13% R:13% L:11% E:9% P:8% I:5% S:5% N:4% D:4% G:4% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6hb4 | T (Hbond turn) | e (exposed) | 54.2 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [ctgtgcagacattcaattgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6hb4_A_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |