|
|
| PID | QueryLength | FocusSite | TITLE |
| 2624989 | 215 | 173 K | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
| AC/ID | AC:P09429 ID:HMGB1_HUMAN |
| Feature Table for 173-th site |
MOD_RES: /note="N6-acetyllysine" COMPBIAS: /note="Basic and acidic residues" REGION: /note="Binding to AGER/RAGE" REGION: /note="Disordered" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
K:23% G:13% R:12% I:7% V:7% D:6% M:6% Q:5% E:4% P:4% S:4% T:4% A:3% L:1% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 6hb4 |
S (bend) | e (exposed) | 90.5 |
| Predicted Bind Molecules |
| nucleotide:8 precipitant:1 |
| Templates for 3D complexes |
|
nucleotide [taacagtcaccccccaacXaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3tq6_A_1_C_1 [taagttggttatcgggaccggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4nnu_A_1_C_1 4nnu_B_1_D_1 [ctgtgcagacattcaattgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6hb4_A_1_B_1 6hb4_D_1_E_1 6hb4_G_1_H_1 6hb4_J_1_K_1 [tagcctttctattagctcttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbw_A_1_C_1
precipitant [EDO ] 7lbw_A_1_H_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 173-rd Site(K)