|
|
| PID | QueryLength | FocusSite | TITLE |
| 2624989 | 215 | 131 E | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
| AC/ID | AC:P09429 ID:HMGB1_HUMAN |
| Feature Table for 131-th site |
HELIX: DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
E:42% A:13% K:11% D:7% R:5% Q:5% S:5% N:4% G:2% L:2% I:1% T:1% Y:1% V:1% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 2yrq |
H (alpha-helix) | e (exposed) | 45.2 |
| Predicted Bind Molecules |
| nucleotide:4 |
| Templates for 3D complexes |
|
nucleotide [tttattattttatattatataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5jgh_D_1_B_1 [xxggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cil_E_1_H_1 [xxxxgatctggcctgtcttacacagtgatacagcccttaacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oen_J_1_F_1 6oeo_I_1_F_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 131-st Site(E)