|
|
| PID | QueryLength | FocusSite | TITLE |
| 2624989 | 215 | 119 G | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
| AC/ID | AC:P09429 ID:HMGB1_HUMAN |
| Feature Table for 119-th site |
STRAND: DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
G:27% D:22% N:15% A:7% E:7% S:7% T:4% R:3% Q:3% H:3% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 2yrq |
S (bend) | e (exposed) | 86.9 |
| Predicted Bind Molecules |
| homo:1 nucleotide:2 |
| Templates for 3D complexes |
|
homo [18949:HMGD_DROME
] 3nm9_B_1_E_1
nucleotide [xxxxgatctggcctgtcttacacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oem_I_1_H_1 6oen_I_1_H_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 119-th Site(G)