Summary for the 111-st Site(P)
PID QueryLength FocusSite TITLE
2624989 215 111 P RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 111-th site HELIX:
DNA_BIND: /note="HMG box 2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
E:17% Q:14% A:12% P:12% R:11% K:11% S:7% V:5% D:4% G:3% N:2%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq H (alpha-helix) e (exposed) 60.5
3D Complex Information
Predicted Bind Molecules
nucleotide:2
Templates for 3D complexes
nucleotide [ctaagagctaatagaaaggctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbw_A_1_F_1 [ttagttggggggtgactgttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbx_A_1_D_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]