Summary for the 111-st Site(P) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 111 P | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 111-th site |
HELIX: DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
E:17% Q:14% A:12% P:12% R:11% K:11% S:7% V:5% D:4% G:3% N:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | H (alpha-helix) | e (exposed) | 60.5 |
Predicted Bind Molecules |
nucleotide:2 |
Templates for 3D complexes |
nucleotide [ctaagagctaatagaaaggctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbw_A_1_F_1 [ttagttggggggtgactgttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbx_A_1_D_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |