Summary for the 11-st Site(G)
PID QueryLength FocusSite TITLE
2624989 215 11 G RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 11-th site VARIANT: /note="G -> R (in gastric-carcinoma cell line)" /id="VAR_046451"
SITE: /note="Cleavage; by thrombin:thrombomodulin"
REGION: /note="LPS binding (delipidated)"
DNA_BIND: /note="HMG box 1"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
VARIANT for 11-th site G->R US " Gastric-carcinoma cell line"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
R:51% G:15% A:8% P:7% Q:3% H:3% S:3% V:3% N:1% D:1% E:1% I:1% L:1% K:1% F:1% T:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq (coil) e (exposed) 23.8
3D Complex Information
Predicted Bind Molecules
nucleotide:4
Templates for 3D complexes
nucleotide [ggaaggtccagagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_B_1 [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_C_1 4qr9_B_1_D_1 [cgggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatccagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cij_G_1_F_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]