Summary for the 101-st Site(A) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 101 A | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 101-th site |
HELIX: REGION: /note="Cytokine-stimulating activity" DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:60% G:14% S:11% I:6% P:6% M:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | H (alpha-helix) | b (buried) | 0.0 |
Predicted Bind Molecules |
nucleotide:8 |
Templates for 3D complexes |
nucleotide [tttattattttatattatataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5jgh_A_1_B_1 5jgh_G_1_H_1 5jgh_J_1_K_1 [aataataaattatataatataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5jh0_A_1_B_1 [xxxxgatctggcctgtcttacacagtgatacagcccttaacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oem_J_1_F_1 6oen_J_1_F_1 6oeo_I_1_F_1 [tagcctttctattagctcttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbw_B_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |