Summary for the 39-th Site(S) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 39 S | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 39-th site |
MUTAGEN: /note="S->A: Greatly reduces phosphorylation, nuclear localization; when associated with A-35; A-42; A-46; A-53 and A-181." MUTAGEN: /note="S->E: Cytoplasmic localization (phosphorylation mimicking); when associated with E-35; E-42; E-46; E-53 and E-181." HELIX: MOTIF: /note="Nuclear localization signal (NLS) 1" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:21% G:19% T:19% A:18% P:7% R:5% K:3% I:2% V:2% L:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | H (alpha-helix) | e (exposed) | 53.1 |
Predicted Bind Molecules |
hetero:1 nucleotide:7 |
Templates for 3D complexes |
hetero [14906:P53_HUMAN ] 2ly4_A_1_B_1 nucleotide [ccXctctggaccttccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_A_1 [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_D_1 4qr9_B_1_C_1 [cacagtgatgcaaatcaagtgtgaagccagacaaaaaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5zdz_E_1_K_1 5ze0_E_1_K_1 5ze1_E_1_K_1 [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5ze2_E_1_J_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |