Summary for the 35-th Site(S) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 35 S | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 35-th site |
MOD_RES: /note="Phosphoserine" ECO:0007744|PubMed:20068231, ECO:0007744|PubMed:21406692, ECO:0007744|PubMed:23186163" MUTAGEN: /note="S->A: Greatly reduces phosphorylation, nuclear localization; when associated with A-39; A-42; A-46; A-53 and A-181." MUTAGEN: /note="S->E: Cytoplasmic localization (phosphorylation mimicking); when associated with E-39; E-42; E-46; E-53 and E-181." MOTIF: /note="Nuclear localization signal (NLS) 1" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:24% S:22% G:15% T:8% N:7% P:6% E:4% Y:4% A:3% R:1% D:1% Q:1% I:1% L:1% F:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | (coil) | e (exposed) | 89.8 |
Predicted Bind Molecules |
hetero:1 homo:2 nucleotide:2 |
Templates for 3D complexes |
hetero [14906:P53_HUMAN ] 2ly4_A_1_B_1 homo [18628:HMGB1_RAT ] 4qr9_A_1_B_1 4qr9_B_1_A_1 nucleotide [cgggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatccagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cg0_K_1_H_1 [cgggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatccagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cij_G_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |