Summary for the 28-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 28 K | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 28-th site |
MOD_RES: /note="N6-acetyllysine" CROSSLNK: /note="Isoglutamyl lysine isopeptide (Lys-Gln) (interchain with Q-?)" HELIX: MOTIF: /note="Nuclear localization signal (NLS) 1" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:65% R:13% V:8% Q:7% G:2% I:2% L:2% N:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | H (alpha-helix) | e (exposed) | 51.4 |
Predicted Bind Molecules |
hetero:1 nucleotide:4 |
Templates for 3D complexes |
hetero [14906:P53_HUMAN ] 2ly4_A_1_B_1 nucleotide [ggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5zdz_E_1_I_1 5ze0_E_1_I_1 5ze1_E_1_I_1 [cggtttttgtctggcttcacacttgatttgcatcactgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5ze2_E_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |