Summary for the 15-th Site(S)

PID QueryLength FocusSite TITLE
2624989 215 15 S RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 15-th site REGION: /note="LPS binding (delipidated)"
DNA_BIND: /note="HMG box 1"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
A:60% S:24% G:11% P:6% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq H (alpha-helix) b (buried) 13.3
3D Complex Information
Predicted Bind Molecules
nucleotide:5
Templates for 3D complexes
nucleotide [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_D_1 4qr9_B_1_C_1 [cacagtgatgcaaatcaagtgtgaagccagacaaaaaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5ze0_E_1_K_1 5ze1_E_1_K_1 [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cij_G_1_K_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]