Summary for the 13-rd Site(M) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 13 M | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 13-th site |
REGION: /note="LPS binding (delipidated)" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
M:27% L:26% V:17% P:7% T:7% K:5% R:3% A:2% I:2% S:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | (coil) | b (buried) | 11.6 |
Predicted Bind Molecules |
hetero:1 nucleotide:6 |
Templates for 3D complexes |
hetero [14906:P53_HUMAN ] 2ly4_A_1_B_1 nucleotide [ggaaggtccagagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_B_1 [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_C_1 4qr9_B_1_D_1 [ggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5zdz_E_1_I_1 5ze0_E_1_I_1 5ze1_E_1_I_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |