Summary for the 114-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 114 K | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 114-th site |
HELIX: DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:49% R:16% I:8% A:7% Q:6% M:3% V:3% N:2% L:2% C:1% T:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | H (alpha-helix) | e (exposed) | 41.5 |
Predicted Bind Molecules |
nucleotide:2 |
Templates for 3D complexes |
nucleotide [xxxxgatctggcctgtcttacacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oem_I_1_H_1 6oen_I_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |