Summary for the 11-st Site(G) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 11 G | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 11-th site |
VARIANT: /note="G -> R (in gastric-carcinoma cell line)" /id="VAR_046451" SITE: /note="Cleavage; by thrombin:thrombomodulin" REGION: /note="LPS binding (delipidated)" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
VARIANT for 11-th site |
G->R US " Gastric-carcinoma cell line" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:51% G:15% A:8% P:7% Q:3% H:3% S:3% V:3% N:1% D:1% E:1% I:1% L:1% K:1% F:1% T:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | (coil) | e (exposed) | 23.8 |
Predicted Bind Molecules |
nucleotide:4 |
Templates for 3D complexes |
nucleotide [ggaaggtccagagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_B_1 [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_C_1 4qr9_B_1_D_1 [cgggtttttgtctggcttcacacttgatttgcatcactgtgtaagacaggccagatccagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cij_G_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |