|
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 106 C | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 106-th site |
MOD_RES: /note="Cysteine sulfonic acid (-SO3H)" MUTAGEN: /note="C->S: Inhibits oxidation-dependent inactivation of immunostimmulatory activity in apoptotic cells." HELIX: REGION: /note="Cytokine-stimulating activity" DNA_BIND: /note="HMG box 2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
![]() |
S:25% C:16% L:13% A:9% M:8% V:6% I:5% F:5% K:4% Q:2% T:2% Y:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
H (alpha-helix) | b (buried) | 8.7 |
Predicted Bind Molecules |
nucleotide:3 precipitant:2 |
Templates for 3D complexes |
nucleotide [xxxxgatctggcctgtcttacacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |