Summary for the 96-th Site(K)

PID QueryLength FocusSite TITLE
2624989 215 96 K RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 96-th site REGION: /note="LPS binding (Lipid A)"
REGION: /note="Cytokine-stimulating activity"
DNA_BIND: /note="HMG box 2"
REGION: /note="Sufficient for interaction with HAVCR2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:87% R:6% Q:3% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq (coil) e (exposed) 61.8
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:10
Templates for 3D complexes
homo [18949:HMGD_DROME ] 3nm9_E_1_B_1 nucleotide [ggggtgattgttcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1j5n_C_1_A_1 [gcgatatcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1qrv_C_1_B_1 [gcattgtttagatcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_B_1 [xgcgatatcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3nm9_A_1_O_1 3nm9_B_1_J_1 3nm9_C_1_J_1 3nm9_E_1_P_1 [ggcgatatcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3nm9_D_1_N_1 3nm9_F_1_N_1 [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6cg0_K_1_J_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]