Summary for the 114-th Site(K)

PID QueryLength FocusSite TITLE
2624989 215 114 K RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 114-th site HELIX:
DNA_BIND: /note="HMG box 2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:49% R:16% I:8% A:7% Q:6% M:3% V:3% N:2% L:2% C:1% T:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq H (alpha-helix) e (exposed) 41.5
3D Complex Information
Predicted Bind Molecules
nucleotide:6
Templates for 3D complexes
nucleotide [ggggtgattgttcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1j5n_C_1_A_1 [gcgatatcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1qrv_C_1_B_1 [xgcgatatcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3nm9_A_1_G_1 3nm9_C_1_K_1 [xxxxgatctggcctgtcttacacagtgatgcaaatcaagtgtgaagccagacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oem_I_1_H_1 6oen_I_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]