Summary for the 43-rd Site(K) |
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 43 K | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 43-th site |
MOD_RES: /note="N6-acetyllysine" CROSSLNK: /note="Isoglutamyl lysine isopeptide (Lys-Gln) (interchain with Q-?)" HELIX: MOTIF: /note="Nuclear localization signal (NLS) 1" DNA_BIND: /note="HMG box 1" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:61% R:21% S:9% Q:3% V:3% N:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
2yrq | H (alpha-helix) | e (exposed) | 67.9 |
Predicted Bind Molecules |
nucleotide:12 |
Templates for 3D complexes |
nucleotide [ccXctctggaccttccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ckt_C_1_A_1 [gcattgtttagatcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2gzk_C_1_B_1 [atatcgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4qr9_A_1_D_1 4qr9_B_1_C_1 [tttattattttatattatataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5jgh_A_1_E_1 5jgh_G_1_K_1 5jgh_J_1_H_1 [aataataaattatataatataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5jh0_A_1_E_1 [cacagtgatgcaaatcaagtgtgaagccagacaaaaaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5zdz_E_1_K_1 5ze0_E_1_K_1 5ze1_E_1_K_1 [cacagtgatgcaaatcaagtgtgaagccagacaaaaacccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5ze2_E_1_J_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |